View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_45 (Length: 204)
Name: NF10101_low_45
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 86 - 192
Target Start/End: Complemental strand, 3158683 - 3158577
Alignment:
| Q |
86 |
tcaattagtctcacaagtgcttaatatcaataaaaaagctcaaataacctaattcaacaagcccttactctaatttaaccgatagagaagaaaacacgca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
3158683 |
tcaattagtctcacaagtgcttaatatcaataaaaaagctcaaataacctaattcaacaagcccttactctaatttaacagatagagaagaaaacacgta |
3158584 |
T |
 |
| Q |
186 |
ccctttg |
192 |
Q |
| |
|
||||||| |
|
|
| T |
3158583 |
ccctttg |
3158577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 17 - 86
Target Start/End: Complemental strand, 3158852 - 3158783
Alignment:
| Q |
17 |
aaatctttcttccttgtaaaggcaatctgaaaatgatttcattctactagttaagcaccggaccatgttt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3158852 |
aaatctttcttccttgtaaaggcaatctgaaaatgatttcattctactagttaagtaccggaccatgttt |
3158783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University