View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_8 (Length: 387)
Name: NF10101_low_8
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 17328060 - 17328278
Alignment:
| Q |
1 |
aagggttgaaactagcaccacctaagattcttccaataaggcttattgtgaggatgattattgtgtttaggatggttgtgatgaataggcctggtagtga |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17328060 |
aagggttaaaactagcaccacctaagattcttccaataaggcttattgtgaggatgattattgtgtttaggatggttgtgatgaataagcctggtagtga |
17328159 |
T |
 |
| Q |
101 |
aagtggttgaaggttgagaaatagagatgtttttgtagagagaattcttaatgttgagatgaagaaaacaaatattgatgttagaattgcatctcctatg |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17328160 |
aagtggttgaaggttgagaaaaagagatgtttttgtagagagaattcttaatgttgagatgaagaaaacaaatattgatgttagaattgcatctcctatg |
17328259 |
T |
 |
| Q |
201 |
gctgatttaatcactccca |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
17328260 |
gctgatttaatcactccca |
17328278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 278 - 330
Target Start/End: Original strand, 17328339 - 17328391
Alignment:
| Q |
278 |
attggtattggaacttggaagatgaaacactctcactcacttattttggatgt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17328339 |
attggtattggaacttggaagatgaaacactctcactcacatattttggatgt |
17328391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University