View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10102_high_11 (Length: 255)

Name: NF10102_high_11
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10102_high_11
NF10102_high_11
[»] chr5 (1 HSPs)
chr5 (192-251)||(38633324-38633383)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 38633383 - 38633324
Alignment:
192 cttgaaaatgtgatgcgacaaaatgatcatcaaaataattaaacatttttcttctctctc 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
38633383 cttgaaaatgtgatgcgacaaaatgatcatcaaaataattaaacatttttcttccctctc 38633324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University