View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_high_11 (Length: 255)
Name: NF10102_high_11
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 38633383 - 38633324
Alignment:
| Q |
192 |
cttgaaaatgtgatgcgacaaaatgatcatcaaaataattaaacatttttcttctctctc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38633383 |
cttgaaaatgtgatgcgacaaaatgatcatcaaaataattaaacatttttcttccctctc |
38633324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University