View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_high_4 (Length: 428)
Name: NF10102_high_4
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 1 - 413
Target Start/End: Complemental strand, 33525510 - 33525098
Alignment:
| Q |
1 |
atcttcttcttcatcttcatcttctgttgagatatcggttccagagaaggatccaaagcaacgatggtcaaagcgtatggctcgtaaacaagtgaagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525510 |
atcttcttcttcatcttcatcttctgttgtgatatcggttccagagaaggatccaaagcaacgaaggtcaaagcgtatggctcgtaaacaagtgaagaat |
33525411 |
T |
 |
| Q |
101 |
tgcataatctctttcttgaaaccgagagattcggcccaattgagacgcnnnnnnngcttcttgttgttatgaattttctctatctcttccatcaccgact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
33525410 |
tgcataatctctttcttgaaaccgagagattcggcccaattgagacgctttttttgcttcttgtcgttatgaattttctctatctcttccatcaccgatt |
33525311 |
T |
 |
| Q |
201 |
gccagttcctacaagcagaatttttaggcctcattttgatttgtccggcacaggtaacttttggagaggttggttccgaattttcggatcccattgactt |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33525310 |
gccagctcctacaagcagaatttttaggcctcattttgatttgtccggcacaggtaacttttggagaggttggttccgaattttcagatcccattgactt |
33525211 |
T |
 |
| Q |
301 |
gtttttagtccataacataggactaccggcttgaccaccaccactaatacttccaccagctctggagattgatctcttacgctgatggtaagttttgtgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525210 |
gtttttagtccataacataggactaccggcttgaccaccaccactgatacttccaccagctctggagattgatctcttacgctgatggtaagttttgtgg |
33525111 |
T |
 |
| Q |
401 |
tggtggtgtttgt |
413 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33525110 |
tggtggtgtttgt |
33525098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University