View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_11 (Length: 352)
Name: NF10102_low_11
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10102_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 6 - 344
Target Start/End: Complemental strand, 29280596 - 29280258
Alignment:
Q |
6 |
acggtaatggtgctggttttggtgatcgtggatcggaagaagaaaaaagaaaaggtgtagatggtgagaatgaaaaggttgatgatgtgtatgaatttgg |
105 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29280596 |
acggtaatggtgctggttttggtgattgtggatcggaagaagaaaaaagaaaaggtgtagatggtgagaatgaaaaggttgatgatgtgtatgaatttgg |
29280497 |
T |
 |
Q |
106 |
aatcaagtgtttgaagaagctttgtgttgcatttggaggggacaaagttttggctgttgctcatgaactgttgactaaatattacttggattcagctgac |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29280496 |
aatcaagtgtttgaagaagctttgtgttgcatttggaggggacaaagttttggctgttgctcatgaactgttgactaaatattacttggattcagctgac |
29280397 |
T |
 |
Q |
206 |
tggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcataactataatctcttgttcttt |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
29280396 |
tggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcatagctataatctcttgttcttt |
29280297 |
T |
 |
Q |
306 |
cattaacatctttcatgcatatgatattgatcctatgct |
344 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
29280296 |
cattaacatctttcatgcatatgatattgatactatgct |
29280258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University