View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_14 (Length: 322)
Name: NF10102_low_14
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 6 - 103
Target Start/End: Complemental strand, 30347654 - 30347557
Alignment:
| Q |
6 |
atcaagatcactcttacttttgttactgctcttgaacataatcttatctacaataggtttatggacacatttctttctaaacaatgtgaactttgaaa |
103 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30347654 |
atcaagatcactcttactcttgttattgctcttgaacataatcttatctacaataggtttatggacacatttctttctaaacaatgtgaactttgaaa |
30347557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 218 - 272
Target Start/End: Complemental strand, 24750553 - 24750499
Alignment:
| Q |
218 |
tatgagaaaagagggaagtatagaaaaagtacccatcaaggggccaagtgaagag |
272 |
Q |
| |
|
|||||| | |||||||| ||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24750553 |
tatgagcatagagggaaatatggaaaaagtatccatcgaggggccaagtgaagag |
24750499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University