View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_17 (Length: 291)
Name: NF10102_low_17
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 1536234 - 1536477
Alignment:
| Q |
1 |
agagacaagatggagcagtgttgacgatagttttgaggccattacagcatgatccttctggttgggttagggtgctgccgtttgtaagaaatgagaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1536234 |
agagacaagatggagcagtgttgacgatagttttgaggccattacagcatgatccttctggttgggttagggtgctgccgtttgtaagaaatgagaaaca |
1536333 |
T |
|
| Q |
101 |
atcagtcatggcaagaacaagttttgaacactcaccggagggtgatgatgaagcaccattggtaaaatcaagggcacatatgccaaaaatgatgcataga |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1536334 |
atcagtcatggcgagaacaagttttgaacactcaccggagggtgatgatgaagcaccattggtaaaatcaagggcacatatgccaaaaatgatgcataga |
1536433 |
T |
|
| Q |
201 |
atgagtgaaaactttgatgccatggataagagacagtaggtttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1536434 |
atgagtgaaaactttgatgccatggataagagacagcaggtttc |
1536477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University