View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_27 (Length: 239)
Name: NF10102_low_27
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 49840931 - 49841155
Alignment:
| Q |
1 |
atttggaatttcctttgagtagttcttgatccttgcttattccattgtttcaactttcaattaccacaaacaagnnnnnnncccct--ctgttaggaact |
98 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
49840931 |
atttggaattttctttgagtagttcttgatccttgcttattccattgtttcaactttcaattaccacaaacaagtttttttcccctttctgttaggaact |
49841030 |
T |
|
| Q |
99 |
tgctgctagactaagggatgtagtggcagtaagacgacaaattgatgaccttccgtgccaatcggaaattgtccagtaagtttgcttctttatactctgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49841031 |
tgctgctagactaagggatgtagtggcagtaagacgacaaattgatgaccttccctgccaatcggaaattgtccagtaagtttgcttctttatactctgc |
49841130 |
T |
|
| Q |
199 |
ataactctttcctgaatgaaattca |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49841131 |
ataactctttcctgaatgaaattca |
49841155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University