View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_28 (Length: 238)
Name: NF10102_low_28
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 44598351 - 44598574
Alignment:
| Q |
1 |
acatttccctcaatgtatcattgccacaaatagcaagcatgtaatccgcaggatcgatggcaaataattccctcagatgcctaaatacccaacaaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44598351 |
acatttccctcaatgtatcattgccacaaatagcaagcatgtaatccgcaggatcgatagcaaataattccctcagatgcctaaatacccaacaaagaaa |
44598450 |
T |
 |
| Q |
101 |
caaacaaccacccaccaaaatacaaacatcattaatacacacacattatcaattaaacaatcaacataagaaaattgatgcagaaattatttccacctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44598451 |
caaacaaccacccaccaaaatacaaacatcattaatacacacacaacatcaattaaacaatcaacataagaaaattgatgcagaaattatttccacctga |
44598550 |
T |
 |
| Q |
201 |
acaccacaggacagtagtctttcc |
224 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
44598551 |
acaccacagggcagtagtctttcc |
44598574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 39806507 - 39806577
Alignment:
| Q |
17 |
atcattgccacaaatagcaagcatgtaatccgcaggatcgatggcaaataattccctcagatgcctaaata |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
39806507 |
atcatttccacaaatagcatgcatgtaatccgcaggatctatggcaaataattcccttagatgtctaaata |
39806577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University