View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10102_low_32 (Length: 225)

Name: NF10102_low_32
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10102_low_32
NF10102_low_32
[»] chr2 (2 HSPs)
chr2 (147-217)||(1535868-1535938)
chr2 (1-46)||(1536039-1536084)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 147 - 217
Target Start/End: Complemental strand, 1535938 - 1535868
Alignment:
147 atcttaagtttgtgtttctatataatagtgatgagttattgttgttttttgcagtgcctaatgcctatgct 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
1535938 atcttaagtttgtgtttctatataatagtgatgagttattgttgttttttgcagtgcctaatgcctctgct 1535868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 1536084 - 1536039
Alignment:
1 tcattcattaccactcatttggattttctcatatatttcatccttt 46  Q
    |||||||||||||||||||||||||||||| |||||||||||||||    
1536084 tcattcattaccactcatttggattttctcttatatttcatccttt 1536039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University