View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_32 (Length: 225)
Name: NF10102_low_32
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 147 - 217
Target Start/End: Complemental strand, 1535938 - 1535868
Alignment:
| Q |
147 |
atcttaagtttgtgtttctatataatagtgatgagttattgttgttttttgcagtgcctaatgcctatgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1535938 |
atcttaagtttgtgtttctatataatagtgatgagttattgttgttttttgcagtgcctaatgcctctgct |
1535868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 1536084 - 1536039
Alignment:
| Q |
1 |
tcattcattaccactcatttggattttctcatatatttcatccttt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1536084 |
tcattcattaccactcatttggattttctcttatatttcatccttt |
1536039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University