View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10102_low_33 (Length: 218)

Name: NF10102_low_33
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10102_low_33
NF10102_low_33
[»] chr4 (1 HSPs)
chr4 (1-218)||(27054458-27054675)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 27054675 - 27054458
Alignment:
1 tgctggctcgaataagaagcaggtgaccaggcagccaaaatattaacccccggagcagcaatatcaggctgcaatgcaacagtttgatgaaagataaagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27054675 tgctggctcgaataagaagcaggtgaccaggcagccaaaatattaacccccggagcagcaatatcaggctgcaatgcaacagtttgatgaaagataaagc 27054576  T
101 tttagattttagttaagataaaccaaatgtttctttgtaggaggaatggttacaacctttaaaactgagggagaaagtgaactcggtccgcgtgaagaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27054575 tttagattttagttaagataaaccaaatgtttctttgtaggaggaatggttacaacctttaaaactgagggagaaagtgaactcggtccgcgcgaagaga 27054476  T
201 agaatgccacatcggggg 218  Q
    | ||||||||||||||||    
27054475 ataatgccacatcggggg 27054458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University