View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_33 (Length: 218)
Name: NF10102_low_33
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10102_low_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 27054675 - 27054458
Alignment:
| Q |
1 |
tgctggctcgaataagaagcaggtgaccaggcagccaaaatattaacccccggagcagcaatatcaggctgcaatgcaacagtttgatgaaagataaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27054675 |
tgctggctcgaataagaagcaggtgaccaggcagccaaaatattaacccccggagcagcaatatcaggctgcaatgcaacagtttgatgaaagataaagc |
27054576 |
T |
 |
| Q |
101 |
tttagattttagttaagataaaccaaatgtttctttgtaggaggaatggttacaacctttaaaactgagggagaaagtgaactcggtccgcgtgaagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27054575 |
tttagattttagttaagataaaccaaatgtttctttgtaggaggaatggttacaacctttaaaactgagggagaaagtgaactcggtccgcgcgaagaga |
27054476 |
T |
 |
| Q |
201 |
agaatgccacatcggggg |
218 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
27054475 |
ataatgccacatcggggg |
27054458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University