View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10102_low_34 (Length: 209)
Name: NF10102_low_34
Description: NF10102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10102_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 32084984 - 32084847
Alignment:
Q |
1 |
atttcttgttgactaatgtttttctagttttatgttggacttctagaattaaattctaacataaaatctaacgatatattcttcatacaatcaatatcca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
32084984 |
atttcttgttgactaatgtttttctagttttatgttggacttctagaattaaattctaacataaaatctaacgatacattcttcatacaatcaatatcca |
32084885 |
T |
 |
Q |
101 |
tgtccctcgcacgcaagtccatttctagatacgcatat |
138 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||| |
|
|
T |
32084884 |
tgtccctcgcacgcatgtccatttctagatacgcatat |
32084847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University