View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_18 (Length: 299)
Name: NF10103_high_18
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_high_18 |
 |  |
|
[»] scaffold0288 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 141 - 290
Target Start/End: Original strand, 11278 - 11425
Alignment:
Q |
141 |
ctgctaagtgttatttagtgatttcaaaagagagatgacaaaaagatatgaattaagaaacatcactcaattcacattgtccaacgaaatatttgcctta |
240 |
Q |
|
|
|||||||||| |||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
11278 |
ctgctaagtgctatttagtgacttcaaaagagaga--aaaaaaagatatgaattaagaaacatcactcaattcacattgtccaacgaaatatttacctta |
11375 |
T |
 |
Q |
241 |
tcaaatgcattgaacacatcatccttgacaatttcaatatgtatctctgc |
290 |
Q |
|
|
| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
11376 |
taaaatgcattgaacacatcatccttgacaatttcactatgtatctctgc |
11425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University