View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_22 (Length: 266)
Name: NF10103_high_22
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 128 - 256
Target Start/End: Original strand, 2480735 - 2480863
Alignment:
| Q |
128 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480735 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
2480834 |
T |
 |
| Q |
228 |
ccatgatcgattggtgcctaatgcctttg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2480835 |
ccatgatcgattggtgcctaatgcctttg |
2480863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 216
Target Start/End: Complemental strand, 49532403 - 49532342
Alignment:
| Q |
155 |
aaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaactt |
216 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||| || || || |||||||||||||| |
|
|
| T |
49532403 |
aaagggtggcgaatttctgacacccaagagccccactggcgctgcctgactcctctgaactt |
49532342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University