View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_24 (Length: 254)
Name: NF10103_high_24
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 7875114 - 7874872
Alignment:
| Q |
1 |
ccattatttttgcaccactttgatattaagtctttcatgacaatatttggagtcaatgtcatatgaggcagttccttttctgtttttggacatatagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7875114 |
ccattatttttgcaccactttgatatcaagtctttcatgacaatatttggagtcaatgtcatatgaggcagttccttttctgtttttggacatatagttt |
7875015 |
T |
 |
| Q |
101 |
taccctcattaatccactttcttatccacattctttcatatgttactccagaagcaatgataacaggatcatacatcagccttgaggatattggacactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7875014 |
taccctcattaatccactttcttatccacattctttcatatgttactccagaagcaatgataacaggatcatgcatcagccttgaggatattggacactt |
7874915 |
T |
 |
| Q |
201 |
gtattcctcaggtggtgccactctatctgactgattcatctca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874914 |
gtattcctcaggtggtgccactctatctgactgattcatctca |
7874872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 100 - 183
Target Start/End: Original strand, 32838245 - 32838328
Alignment:
| Q |
100 |
ttaccctcattaatccactttcttatccacattctttcatatgttactccagaagcaatgataacaggatcatacatcagcctt |
183 |
Q |
| |
|
|||||||||| || ||| ||| ||||||||| | || |||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
32838245 |
ttaccctcatcaaaccatttttgtatccacatccgctcgtatgtttctcctgaagcaatgacaacaggatcatacatcaacctt |
32838328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 34511494 - 34511536
Alignment:
| Q |
134 |
tttcatatgttactccagaagcaatgataacaggatcatacat |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34511494 |
tttcatatgtttgcccagaagcaatgataacaggatcatacat |
34511536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University