View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_28 (Length: 241)
Name: NF10103_high_28
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 6373994 - 6373764
Alignment:
| Q |
1 |
tgattccttgcgatttaagaaacggatggttgaattgcaagaatctcctttatcatataaaatgttttgaggtagcagcactttgttgcacctctttttg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6373994 |
tgattccttgcgatttaagaaacagatggttgaattgcaagaatctcctttatcatataaaatgtt--gaggtagcagcactttgttgcacctctttttg |
6373897 |
T |
 |
| Q |
101 |
gtttaaaaaata-----------gatgatccctaaaacaattagggtggaaaagggaaatggtacataagaataccgagactaccatttttagaaatgat |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6373896 |
gtttaaaaaataaataaaaaatagatgatccctaaaacaattagggtggaaaagggaaatggtacataagaatactgagactaccatttttagaaatgat |
6373797 |
T |
 |
| Q |
190 |
tgattagtagtaaacaaaagcagaaagtattataac |
225 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| |
|
|
| T |
6373796 |
tgatt---agtaaacaaaagcggaaagtattataac |
6373764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University