View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_33 (Length: 230)
Name: NF10103_high_33
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 22 - 220
Target Start/End: Complemental strand, 39836318 - 39836120
Alignment:
| Q |
22 |
aaaggaggagtgtgtaaaagtaggaggaatataaaatcaagaagaaaaacaaagttctaaactnnnnnnngctctctttctcataacaagcaaccatcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39836318 |
aaaggaggagtgtgtaaaagtaggaggaatataaaatcaagaagaaaaacaaagttctaaactaaaaaaagctctctttctcataacaagcaaccatcaa |
39836219 |
T |
 |
| Q |
122 |
attaagtcttatagctgaaatttcattctcataaaaaagttagctttatttctggtccataattcaaccttctctcctcactcaccttttcttctctct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39836218 |
attaagtcttatagctgaaatttcattctcataaaaaagttagctttatttctggtccataattcaaccttctctcctcactcaccttttcttctctct |
39836120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University