View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_high_7 (Length: 399)
Name: NF10103_high_7
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 106 - 383
Target Start/End: Complemental strand, 25108988 - 25108711
Alignment:
Q |
106 |
gaagatatcaacaaggttgagtctagtggaagaaattagatcagagaacctgacaaatattattattttttgttagggatggggttcatttgtcagccga |
205 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25108988 |
gaagatatcaacaaggttgagtctagcggaagaatttagatcagagaacttaataaatattattattttttgttagggatggggttcatttgtcagccga |
25108889 |
T |
 |
Q |
206 |
aggaagcaaggtagtgttgaaggaaatattaagggtccttagagaagcagattggaagccaagtttgcattggatgtcactaccaactgaatatgcagaa |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25108888 |
aggaagcaaggtagtgttgaaggaaatattaagggtccttagagaagcagattggaagccaagtttgcattggatgtcactaccaactgaatatgcagaa |
25108789 |
T |
 |
Q |
306 |
gattcaccatattaccctccaagtgcagatggaaccaccactataaatgtttcttacagtatccctaggaggcatttg |
383 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25108788 |
gattcaccatattaccctccaagtgcagatggaaccaccactataaatgtttcttacagtatccctaggaggcatttg |
25108711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25109093 - 25109057
Alignment:
Q |
1 |
attattccacatagaccccaactcacatccacgtggc |
37 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
25109093 |
attattccacatagaccccaactcacatccacgtggc |
25109057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University