View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_100 (Length: 202)
Name: NF10103_low_100
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 47184013 - 47183843
Alignment:
Q |
15 |
aaggtaaatggttttaggtattatggagttttggtcataagataaataaaatttgaacatagattgatctagttagaatttgatctcaagttaccaatat |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47184013 |
aaggtaaatggttttaggtattatggagttttggtcataagataaataaaatttgaacatagattgatctagttagaatttgatctcaagttaccaatat |
47183914 |
T |
 |
Q |
115 |
cataagaacgtataaatacaaaatcagaacaaaaacctttagaataaggcaatataaatgtacctgaaata |
185 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
47183913 |
cataagaacgtataagtacaaaatcagaacaaaaacctttagaataaggctatataaatgtacctgaaata |
47183843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University