View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_28 (Length: 345)
Name: NF10103_low_28
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 169 - 322
Target Start/End: Original strand, 45399363 - 45399516
Alignment:
| Q |
169 |
aaatgttgcgaccttatgggtcagtttaggcagtgttgtaatacgacgacccaatttcgaacatagagcgaagaccgataattattccatacggccgtgt |
268 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45399363 |
aaatgttgtgaccttatgggtcagtttaggcagtgatgtaatacgacgacccaatttcgaacatagagcgaaggccgataattattccatacggccgtgt |
45399462 |
T |
|
| Q |
269 |
taatgctcatgcatactactcactgccataaatgtaaccattgaaaaaatatga |
322 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45399463 |
taatgctcatgcatactactcaccgccataaatgtaaccattgaaaaaatatga |
45399516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 7 - 80
Target Start/End: Original strand, 45399294 - 45399367
Alignment:
| Q |
7 |
agatgttagatctcaaaccatgagagtaggaggcatgggcgtgcctaaacccatattagtagtgttcacaaatg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45399294 |
agatgttagatctcaaaccatgagagtaggaggcatgggcgtgcctaaacgcatattagtagtgttcacaaatg |
45399367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University