View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_35 (Length: 332)
Name: NF10103_low_35
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 107 - 314
Target Start/End: Complemental strand, 8768447 - 8768235
Alignment:
| Q |
107 |
tacattttattttcaaataaatctccaataatggtgtgtgtcaaatgggaggcaaggacaaatataaaattttcttattttttatataaga-ttgtcaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8768447 |
tacattttattttcaaataaatctccaataatggtgtgtgtcaaatgggaggcaaggacaaatataaaattttcttattttttatataagatttgtcaca |
8768348 |
T |
 |
| Q |
206 |
tgaagtagtggtacaaacatgatatccca----tagagaacaaaatgtgagtttaaaacaataaccaaagggtaatgaaacatatatgattattacggtc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8768347 |
tgaagtagtggtacaaacatgatatcccatagttagagaacaaaatgtgagtttaaaacaataaccaaagggtaatgaaacatatatgattattacggtc |
8768248 |
T |
 |
| Q |
302 |
aaataaagttgtt |
314 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8768247 |
aaataaagttgtt |
8768235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University