View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10103_low_36 (Length: 330)

Name: NF10103_low_36
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10103_low_36
NF10103_low_36
[»] chr7 (2 HSPs)
chr7 (1-224)||(1632341-1632565)
chr7 (206-311)||(1632582-1632687)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1632341 - 1632565
Alignment:
1 agcagactcggaaatggca-gcccaaagataatcaagacggcataggttcatctaaatctttcgaagctccggtgatcaatgacgttgcagctgacaata 99  Q
    |||||| || ||||||||| |||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
1632341 agcagaatcagaaatggcaagcccaaagataatccagacggcataggttcatctaaagcttttgaagctccggtgatcaatgacgttgcagctgacaata 1632440  T
100 caataccgcaacctgatgctattcaattactatcacaatctggtgccacaaccggacaggaggaggaacggccaattgatgtgtccactccggattttca 199  Q
    |||||||||  ||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||||    
1632441 caataccgcggcctgatgttattcaattactatcacaatctggtgccccaaccggataggaggaggaacggccaattgatgtgtccactccggagtttca 1632540  T
200 agtggaagagcacaaggtcccgcag 224  Q
    | |||||||||||| ||||| ||||    
1632541 aatggaagagcacacggtcctgcag 1632565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 206 - 311
Target Start/End: Original strand, 1632582 - 1632687
Alignment:
206 agagcacaaggtcccgcagacagacaaagagcccttggctgtaacttctgaggtacagaatgttgaatatgaatttcacaaggagcggttacctagtaca 305  Q
    |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1632582 agagcacacggtccagcagacagacaaagagcccttggctgtaacttctgaggtacagaatgttgaatatgaatttcacaaggagcggttacctagtaca 1632681  T
306 tcagtc 311  Q
    ||||||    
1632682 tcagtc 1632687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University