View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_41 (Length: 310)
Name: NF10103_low_41
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 50154883 - 50154818
Alignment:
| Q |
139 |
ccattagagatttgaaattccccgcccctacttttaaagtaaagaagatgaagacttattttcttg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
50154883 |
ccattagagatttgaaatttcccgcccctacttttaaagttaagaagatgaagacttgttttcttg |
50154818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 141
Target Start/End: Original strand, 38173856 - 38173895
Alignment:
| Q |
102 |
atttagctttatagaagcacctttatctccgcttcgccca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38173856 |
atttagctttatagaagcacctttatctccgcttcgccca |
38173895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University