View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_44 (Length: 304)
Name: NF10103_low_44
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 40420159 - 40419969
Alignment:
Q |
1 |
caagaagcagtcaaaacaagttatccatgtttgggtgtgggaatttttgcttagtgagtaaatactaatgatgctagaacaaaccacaatctcagaattc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40420159 |
caagaagcagtcaaaacaagttatccatgtttgggtgtgggaatttttgcttagtgagtaaatactaatgatgctagaacaaaccacaatctcagaattc |
40420060 |
T |
 |
Q |
101 |
cggagatcttgaattgcgatggttgtgcccttattttcaaaatcatactgcagtatgaagaaatttaatgttagaagtttatcataattgc |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
40420059 |
cggagatcttgaattgcgatggttgtgcccttattttcaaaatcatactgcagtatgaagaaatttaatgttagaaatttatcataattgc |
40419969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 233 - 290
Target Start/End: Complemental strand, 40419925 - 40419868
Alignment:
Q |
233 |
gcagttcccacaacaacaaccaaacctcctccaagtggggtcgactacatgaataaac |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
40419925 |
gcagttcccacaacaacaaccaaacctcctccaagtggggtcggctacatgaataaac |
40419868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University