View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_46 (Length: 298)
Name: NF10103_low_46
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 31 - 282
Target Start/End: Complemental strand, 41660304 - 41660054
Alignment:
| Q |
31 |
gtgattcgtctctaatggtagatgtgataaatgaacacataagtattgtttgtcttttagttttggatggttcacacgatcacaaaatataacataaaat |
130 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41660304 |
gtgattcgtctctaatgttagatgtgataaatgaacgcataagtattgtttgtcttttagttttggatggttcacacgatcacaaaatataacataaaat |
41660205 |
T |
|
| Q |
131 |
cgacaatgcaaccatgagcatagtttaaatgctaactgtgtgcatatatagaagaatataacataacataaacgactcatttgggggaaactaaaaccca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
41660204 |
cgacaatgcaaccatgagcatagtttaaatgctaactgtgtgcatatatagaagaatataacataacataaacgtctcatttgggggaaact-aaaccca |
41660106 |
T |
|
| Q |
231 |
aaacatcaatccggaaataatgttaaactgaaataatagcaggcatggtttt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41660105 |
aaacatcaatccggaaataatgttaaactgaaataatagcaggcatggtttt |
41660054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University