View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10103_low_47 (Length: 282)

Name: NF10103_low_47
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10103_low_47
NF10103_low_47
[»] chr3 (1 HSPs)
chr3 (138-275)||(8826159-8826296)


Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 138 - 275
Target Start/End: Original strand, 8826159 - 8826296
Alignment:
138 atctttctgagcttttctagtgccttttgatataacttgatggtaagctttatcatcaacttcaaattgtggtatattttgacattcaaatcttcttgta 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
8826159 atctttctgagcttttctagtgccttttgatataacttgatggtaagctttatcatcaacttcaaattgtggtatattttgatattcaaatcttcttgta 8826258  T
238 atattttcagtggggcatgtgcatatttacctttgctt 275  Q
    | ||||||||||||||||||||||||||||||||||||    
8826259 acattttcagtggggcatgtgcatatttacctttgctt 8826296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University