View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_49 (Length: 279)
Name: NF10103_low_49
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 8003450 - 8003200
Alignment:
| Q |
20 |
aagggaacacattgcttgatttttccttgctcttaatacaaatgtggaatcctataacattaagaatggtaacctaagtatgcggggaactttgttactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003450 |
aagggaacacattgcttgatttttccttactcttaatacaaacgtggaatcctataacattaagaatggtaacctaagtatgcggggaactttgttactg |
8003351 |
T |
 |
| Q |
120 |
gaagactaggcatggttatgagcatcacggcggctaacggaacttgtggctgacaattatctttcactggaaacggcagttggtgagagagttgaggatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003350 |
gaagactaggcatggttatgagcatcacggcggctaacggaacttgtggctgacaattatctttcactggaaacggcagttggtgagagagttgaggatg |
8003251 |
T |
 |
| Q |
220 |
ccaatagtagttcgtgttggaaggaatgaaggtggaaattcaacctttgct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8003250 |
ccaatagtagttcgtgttggaaggaatgaaggtggaagttcaacctttgct |
8003200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 270
Target Start/End: Original strand, 30517851 - 30517887
Alignment:
| Q |
234 |
tgttggaaggaatgaaggtggaaattcaacctttgct |
270 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
30517851 |
tgtttgaaggaatgaaggtggaagttcaacctttgct |
30517887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University