View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10103_low_52 (Length: 266)

Name: NF10103_low_52
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10103_low_52
NF10103_low_52
[»] chr1 (1 HSPs)
chr1 (128-256)||(2480735-2480863)
[»] chr3 (1 HSPs)
chr3 (155-216)||(49532342-49532403)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 128 - 256
Target Start/End: Original strand, 2480735 - 2480863
Alignment:
128 tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2480735 tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta 2480834  T
228 ccatgatcgattggtgcctaatgcctttg 256  Q
    |||||||||||||||||||||||||||||    
2480835 ccatgatcgattggtgcctaatgcctttg 2480863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 216
Target Start/End: Complemental strand, 49532403 - 49532342
Alignment:
155 aaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaactt 216  Q
    |||||||| ||||||||||| ||||| ||||||||||| || || || ||||||||||||||    
49532403 aaagggtggcgaatttctgacacccaagagccccactggcgctgcctgactcctctgaactt 49532342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University