View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_61 (Length: 250)
Name: NF10103_low_61
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 33950782 - 33950542
Alignment:
| Q |
1 |
ataatttaaagcaacaaaaagcaatggctaatgtatcatatatacttgaannnnnnnnaactctaaagtatcagtatcagtatcatatacaattaagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33950782 |
ataatttaaagcaacaaaaagcaatggctaatgtatcatatatacttgaattttttttatctctaaagtatcagtatcagtatcatatacaattaagcaa |
33950683 |
T |
|
| Q |
101 |
tgctatgttaattatgagtaggcataactggtaggtcattaatatctctaaattattagtatagtacaattaagcaactgtctatattattgtgagcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33950682 |
tgctatgttaattatgagtaggcataactggtaggtcattaatatctctaaattattagtatagtacaattaagcaactgtctatattat--tgagcaaa |
33950585 |
T |
|
| Q |
201 |
gcacctggttgatcattttcaatccgtgtgctgttctctgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33950584 |
gcacctggttgatcattttcaatctgtgtgctgttctctgctt |
33950542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University