View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_67 (Length: 250)
Name: NF10103_low_67
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_67 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 3961 - 3723
Alignment:
| Q |
1 |
cgcgcgataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaagatcttggcc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961 |
cgcgccataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaagatcttggcc |
3862 |
T |
 |
| Q |
101 |
tctccactttcactataactatactctatctactctctactgttgttgctgccccc-tttgatgtatgtggctagcatgcatcttgtttatttactcagt |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
3861 |
tctccactttcactacaactatactctatctactctctactgttgttgctgcccccttttgatgtatgtggctagcatgcaacttgtttatttacccagt |
3762 |
T |
 |
| Q |
200 |
atcattgttattttcatttatatatgcagattgttcctt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3761 |
atcattgttattttcatttatatatgcagattgttcctt |
3723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University