View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_69 (Length: 249)
Name: NF10103_low_69
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 43323326 - 43323568
Alignment:
Q |
1 |
atttaaatttaattatagtaatgcactaaacttaaaatagatgaatatttattattgtgatgcaactgggagcaacccgtgctaggttgaattgttctct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
43323326 |
atttaaatttaattatagtaatgcactaaacttaaaatagatgaatatttattattgtgatgcaactgggagcaacccgtgctaggttgaattgttccct |
43323425 |
T |
 |
Q |
101 |
tatgtaaggctcttgagaggtactgcctctagtgatgagtatgtata------------attagatttgaacacacactctgacaaacataacgctcatc |
188 |
Q |
|
|
||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43323426 |
tatgtaaggctgttgagaggtactgcctccagtgatgagtatgtatatcaagtcatcccattagatttgaacacacactctgacaaacataacgctcatc |
43323525 |
T |
 |
Q |
189 |
cgtaagatgtagaagagcttcaaccctagtttctctctcatgt |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43323526 |
cgtaagatgtagaagagcttcaaccctagtttctctctcatgt |
43323568 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University