View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_70 (Length: 247)
Name: NF10103_low_70
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 9296736 - 9296960
Alignment:
| Q |
1 |
ccggtgtcggattaactcgaagtcttgttttcttgataactatgtagtgggtttaagtacccatcgtactcgcattaataccgttttgcttattttagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9296736 |
ccggtgtcggattaactcgaagtcttgttttcttcataactatgtagtgggtttaagtacccatcgtactcgcattaataccgttttgtttattttagaa |
9296835 |
T |
|
| Q |
101 |
aaatgtattttgttgcttatattcgttacgaacaaaatattaaaatttgatttcaagggtgtaatcaatatgtcaagaacttcaatttcaatttcaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
9296836 |
aaatgtattttgttgcttatattcgttacgaacgaaatattaaaattttatttgaagggtttaatcaatatgtcaag------aatttcaatttcaattt |
9296929 |
T |
|
| Q |
201 |
caaaataatcatgattttttgtaggattggt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9296930 |
caaaataatcatgattttttgtaggattggt |
9296960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University