View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_71 (Length: 247)
Name: NF10103_low_71
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 44954959 - 44954739
Alignment:
| Q |
18 |
tatcctttctcaaaaagacagcgttaaatagttaccaatctttctaagaacattcaacaattgtaaactttgcttaaaattgacttttgcctcaggaaaa |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954959 |
tatcctttctcagaaagacagcgttaaatagttaccaatctttctaagaacattcaacaattgtaaactttgcttaaaattgacttttgcctcaggaaaa |
44954860 |
T |
 |
| Q |
118 |
ggattagaaacttttaaaaattaacaatannnnnnnnnnnnnnnnnnnattaaaaagtcacacaaaaataagtctcacactaaataagatataatataaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44954859 |
ggattagaaacttttaaaaattaacaatatttttttaattttttatttattaaaaagtcacacaaaaaaaagtctcacactaaataagatataatataaa |
44954760 |
T |
 |
| Q |
218 |
atgtatagacagtcttcatct |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44954759 |
atgtatagacagtcttcatct |
44954739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University