View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_72 (Length: 247)
Name: NF10103_low_72
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 1533810 - 1533573
Alignment:
| Q |
1 |
tgagcattaacgagtttctgaagcctgctgaaggagagaagtactacaacccaggtggacgtggcggccgtggtagttcaaagggaggaggttatggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1533810 |
tgagcattaacgagtttctgaagcctgctgaaggagagaagtactacaacccaggtggacgtggcggccgtggtagttcaaagggaggaggttatggtgg |
1533711 |
T |
|
| Q |
101 |
aaatgcatatggcaatgtctcagccccatctattgaagaccctgggtaattcccaacattgggtggtggcaagtgagatatttcagtaccatttccccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1533710 |
aaatgcatatggcaatgtctcagccccatctattgaagaccctgggtaattcccaacattgggtggtggcaagtgagatatttcagtaccatttccccta |
1533611 |
T |
|
| Q |
201 |
tcccccctttatttaccttcaattttgagttctctctg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1533610 |
tcccccctttatttaccttcaattttgagttctctctg |
1533573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 1139967 - 1140225
Alignment:
| Q |
1 |
tgagcattaacgagtttctgaagcctgctgaaggagagaagtactacaacccaggtggacgtggcgg------------------ccgtggtagttcaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1139967 |
tgagcattaacgagtttctgaagcctgctgaaggagagaagtactacaacccaggtggacgtggcggtcgtggtggacgtggtggccgtggtggttcaag |
1140066 |
T |
|
| Q |
83 |
gggaggaggt---tatggtggaaatgcatatggcaatgtctcagccccatctattgaagaccctgggtaattcccaacattgggtggtggcaagtgagat |
179 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
1140067 |
gggaggaggtggttatggtggaaatgcatatggcaatgtctcagccccatctattgaggaccctgggcaattcccaaccttgggtggtggtaagtgagat |
1140166 |
T |
|
| Q |
180 |
atttcagtaccatttcccctatcccccctttatttaccttcaattttgagttctctctg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1140167 |
atttcagtaccatttcccctatcccccctttatttaccttcaattttgggttctctctg |
1140225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University