View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_79 (Length: 240)
Name: NF10103_low_79
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 33950782 - 33951006
Alignment:
| Q |
1 |
tatatttgaattaaatttcaagtatgtatgtatacactttcgagagaggtggcataatagaaataggtcacagttcatgtatgtgatttgatatgctcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33950782 |
tatatttgaattaaatttcaagtatgtatgtatacactttcgagagaggtggcataatagaaataggtcacagttcatgtatgtgattggatatgctcga |
33950881 |
T |
|
| Q |
101 |
atcatgaatagcatgctgcaatcagtgattgatacaagcataagatattttcatctaaagagagaaaaatattggataaagaggaagatttttcatcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33950882 |
atcatgaatagcatgctgcaatcagtgattgatacaagcatatgatattttcatctaaagagagaaaaatattggatagagaggaagatttttcatcata |
33950981 |
T |
|
| Q |
201 |
tatatccaatccatgaatgttcatg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33950982 |
tatatccaatccatgaatgttcatg |
33951006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University