View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_80 (Length: 240)
Name: NF10103_low_80
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 59 - 239
Target Start/End: Original strand, 9296507 - 9296697
Alignment:
| Q |
59 |
taacagtaggactaataccaatattatgtggttattttcttatgataaa----------ctctacaatattggcatacaattttatggtcaatattgaat |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9296507 |
taacagtaggactaataccaatattatgtggttattttcttatgataaaatccaataaactctatgatattggcatacaattttatggtcaatattgaat |
9296606 |
T |
|
| Q |
149 |
gctacaaatgattttatcttttcttctaagatgacttttgtcaatgaggtagttcattcgatcaaaagcatgtcttgtcaatgactattgg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
9296607 |
gctacaaatgattttatcttttcttctaagatgactttggtcaatgaggtagttcattcgatcgaaagcaagtcttggcaatgactattgg |
9296697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University