View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_94 (Length: 229)
Name: NF10103_low_94
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 1534077 - 1533858
Alignment:
| Q |
6 |
accaatttaccatttccttgatttttcactatggagttggactttatgttacttgtcgaaactcttgtacttttctctaatttgttttaagtcaaatcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534077 |
accaatttaccatttccttgatttttcactatggagttggactttatgttacttgtcgaaactcttgtacttttctctaatttgttttaagtcaaatcca |
1533978 |
T |
|
| Q |
106 |
cggtgcagtctttttgctttcgttagtgattatggcatcgttgtctttattcagtcgttttgcttttgttattgattatgcaacaatgtctttattttct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1533977 |
cggtgcagtctttttgctttcgttagtgattatggcatcgttgtctttattcagtcgttttgcttttgttattgattatgcaacaatgtctttattttct |
1533878 |
T |
|
| Q |
206 |
ttgatcatatacatcttttc |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1533877 |
ttgatcatatacatcttttc |
1533858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 1139702 - 1139923
Alignment:
| Q |
6 |
accaatttaccatttccttgatttttcactatggagttggactttatgttacttgtcgaaactcttg-tacttttctctaatttgttttaagtcaaatcc |
104 |
Q |
| |
|
||||||||||| || ||||| ||||||||| ||||||||| |||||||||||||| |||||||||| ||||||||||||||||||| |||||| | || |
|
|
| T |
1139702 |
accaatttaccctt-ccttggtttttcactctggagttggtttttatgttacttgtagaaactcttggtacttttctctaatttgtt--aagtcacaccc |
1139798 |
T |
|
| Q |
105 |
acggtgcagtctttttgctttcgttagtgattatggcatcgttgtctttattcagtcgttttgcttttgttattgattatgcaacaatgtctttattttc |
204 |
Q |
| |
|
|| || ||||||||| | || ||| ||||||||||||||| |||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1139799 |
acattgtagtcttttttcgtttgttggtgattatggcatcgctgtcttgatttagttgttttgcttttgttattgattatgcaacaatgtctttattttc |
1139898 |
T |
|
| Q |
205 |
tttgatcatatacatcttttcacat |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1139899 |
tttgatcatatacatcttttcacat |
1139923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University