View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_95 (Length: 226)
Name: NF10103_low_95
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_low_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 41986655 - 41986448
Alignment:
Q |
18 |
ggccacagcggaggcagactggtgtcatctcgatgcaaatcttctca----------------attcaacaatgatcttgatctcattcgtttccgatca |
101 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
T |
41986655 |
ggccacagtggaggcagactggtgtcatctcgatgtaaatcttctcagtttgatatcacaacgattcgacaatgatcttgatctcattcgtttccgatca |
41986556 |
T |
 |
Q |
102 |
gtttgttggacgtggcggagctcttccatctcaaatcaccaccgtcctaatttagtgcccttcaagataaaacattttgagtttcactgtccatcatcat |
201 |
Q |
|
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41986555 |
gtttgttcgacgtggcggtgctcttccatctcaaatcaccaccgtcctaatttagtgcccttcaagataaaacattttgagtttcactgtccatcatcat |
41986456 |
T |
 |
Q |
202 |
cctatttc |
209 |
Q |
|
|
|||||||| |
|
|
T |
41986455 |
cctatttc |
41986448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 140
Target Start/End: Complemental strand, 9417403 - 9417336
Alignment:
Q |
73 |
atgatcttgatctcattcgtttccgatcagtttgttggacgtggcggagctcttccatctcaaatcac |
140 |
Q |
|
|
|||| ||||||||||||| ||| ||||| ||||||| | ||||||| |||||||||| ||||||||| |
|
|
T |
9417403 |
atgaacttgatctcattcattttcgatcggtttgttcaaagtggcggcgctcttccatttcaaatcac |
9417336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 144
Target Start/End: Complemental strand, 41981742 - 41981700
Alignment:
Q |
102 |
gtttgttggacgtggcggagctcttccatctcaaatcaccacc |
144 |
Q |
|
|
||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
T |
41981742 |
gtttgttcgacgtggcggagttctcccatctcaaatcaccacc |
41981700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 142
Target Start/End: Complemental strand, 9408212 - 9408151
Alignment:
Q |
81 |
gatctcattcgtttccgatcagtttgttggacgtggcggagctcttccatctcaaatcacca |
142 |
Q |
|
|
|||||||||| ||| ||||| ||||||| ||||||||| ||| |||||| ||||||||||| |
|
|
T |
9408212 |
gatctcattcattttcgatcggtttgttcaacgtggcggcgctgttccatttcaaatcacca |
9408151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University