View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_97 (Length: 216)
Name: NF10103_low_97
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10103_low_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 7875237 - 7875436
Alignment:
Q |
1 |
acatgtctcttggatcattggacaatagttttagttccgatgtgtcgcgagttaagaccaatcatgccttgaatttgatgatgaccaagagtgatgaaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
7875237 |
acatgtctcttggatcattggacaatagttttagttccgatgtgtcgcgagttaagaccaatcatgccttgaatttgatgatgaccaagagtaatgaaaa |
7875336 |
T |
 |
Q |
101 |
ttctcagcctcacaaggatacagttcatgcagagatacatgatacagatttgatgctcttgcctcaacttcatgatcttcaatgggattctcaatgcaag |
200 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7875337 |
ttctcatcctcacaaggatacagttcatgcagagatacatgatacagatttgatgctcttgcctcaacttcatgatcttcaatgggattctcaatgcaag |
7875436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University