View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_98 (Length: 215)
Name: NF10103_low_98
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 45702720 - 45702810
Alignment:
| Q |
19 |
gaaaaacccttagccacaactcttgttttatactttggttctttaattctctaaataccttctttgttcttgaagatctacttacatccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
45702720 |
gaaaaacccttagccacaactcttgttttatactttggttctttaattctctaaataccttccttgttcttgaagatccacttacatccaa |
45702810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 107 - 208
Target Start/End: Original strand, 45702846 - 45702946
Alignment:
| Q |
107 |
caagtcagttcatctccaatgaatgaatttcctcgttaatggccttcaaactattttagactctcattgctctcaaatgcttttttgaaggcctttgctt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
45702846 |
caagttagttcatctccaatgaatgaatttcctcattcatggcctt-aaactatttcagactctcattgctctcaaatgctttcttgaaggcctttgttt |
45702944 |
T |
|
| Q |
207 |
ct |
208 |
Q |
| |
|
|| |
|
|
| T |
45702945 |
ct |
45702946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University