View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10103_low_99 (Length: 211)
Name: NF10103_low_99
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10103_low_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 7921750 - 7921938
Alignment:
| Q |
16 |
atgaattcttataatttaacaaaatataaggatacttggcggataaaattcatcttaaactatgattaaagatttgatcaat---------attcaatta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
7921750 |
atgaattcttataatttaacaaaatataaggatacttggcggataaaattcatcttaaactatgattaaagatttgaacaattgaatatatattcaatta |
7921849 |
T |
 |
| Q |
107 |
accaagctgtatgtatagtttaacataaaaataaaataaatcatgcatggccaacctaacattgttgctacggcatccaacgtctaggc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7921850 |
accaagctgtatgtatagtttaacataaaaataaaataaatcatgcatggccaacctaacattgttgctacggcatccaacgtctaggc |
7921938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University