View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_11 (Length: 367)
Name: NF10104A_high_11
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 12045216 - 12045373
Alignment:
| Q |
1 |
tccctctcatctcatgtgcttctactccatcacttcacatgtttgcatgtctatagaattcatggattcgttgttgcttgcggtaccatatgaagaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045216 |
tccctctcatctcatgtgcttcttctccatcacttcacatgtttgtatgtctatagaattcatggattcgttgttgcttgcggtaccatatgaagaaaat |
12045315 |
T |
 |
| Q |
101 |
ccttttctgagattttcatatgatgttgcgtaccattgatcttacacagaccacatga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045316 |
ccttttctgagattttcatatgatgttgcgtaccattgatcttacacagaccacatga |
12045373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 213 - 356
Target Start/End: Original strand, 12045428 - 12045571
Alignment:
| Q |
213 |
atatcctatgaagcccaaaaatgaattgtcttaataatgtaaatttaggttgtttcttcatatgaggcgttaatctcctaatagacacgatattgttgct |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045428 |
atatcctatgaagcccaaaaatgaattgtcttaataatgtaaatttaggttgtttcttcatatgaggcgttaatctcctaatagacacgatattgttgct |
12045527 |
T |
 |
| Q |
313 |
ttacttttatctgattttcaaggaatcctaaattgtacctaact |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045528 |
ttacttttatctgattttcaaggaatcctaaattgtacctaact |
12045571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University