View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_13 (Length: 357)
Name: NF10104A_high_13
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 9 - 350
Target Start/End: Original strand, 5053621 - 5053962
Alignment:
| Q |
9 |
atcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaaactaatactaccaactatagattatatatagtggtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053621 |
atcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaaactaatactaccaactatagattatatatagtggtt |
5053720 |
T |
 |
| Q |
109 |
ctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggttgcaatactgttgtggagactttaaaatcccttatat |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053721 |
ctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggttgcaatactgttgtggagactttaaaatcccttatat |
5053820 |
T |
 |
| Q |
209 |
tacagtggcaatactgttgcggaggcttcaaaatcccttatattaccgtggcaatactgttgcggagacttcaaaatccttgatactgcagttgcaatag |
308 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053821 |
tacagtggcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcggagacttcaaaatccttgatactgcagttgcaatag |
5053920 |
T |
 |
| Q |
309 |
tggttactgatactattggagagacttcaaaatcttttatat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053921 |
tggttactgatactattggagagacttcaaaatcttttatat |
5053962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University