View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_21 (Length: 316)
Name: NF10104A_high_21
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 181 - 303
Target Start/End: Original strand, 13608925 - 13609047
Alignment:
| Q |
181 |
catgtgatgatttggaatttctatcctctggtcttctaggccagaatatgcagagattggaaaaattattaaaaagttaacatgcttattgggaaacaaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13608925 |
catgtgatgatttggaatttctatcctctggtcttctaggccagaatatgcagagattggaaaaattattaaaaagttaacatgcttattgggaaacaaa |
13609024 |
T |
 |
| Q |
281 |
acttcaactttacctggcaatat |
303 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13609025 |
acttcaactttacctggcaatat |
13609047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 6 - 123
Target Start/End: Original strand, 13608750 - 13608867
Alignment:
| Q |
6 |
aagtttactaacaaaactttacctgtttcattgaacgaataattttcaaggatttgactgaatttttcaattaattacagtagcactttgtcattatatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13608750 |
aagtttactaacaaaactttacctgtttcattgaacgaataattttcaaggatttgactgaatttttcaattaattacagtagcactttgtcattatatt |
13608849 |
T |
 |
| Q |
106 |
tgatgtttactgtcatga |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13608850 |
tgatgtttactgtcatga |
13608867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 183 - 295
Target Start/End: Original strand, 31244876 - 31244988
Alignment:
| Q |
183 |
tgtgatgatttggaatttctatcctctggtcttctaggccagaatatgcagagattggaaaaattattaaaaagttaacatgcttattgggaaacaaaac |
282 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| || |||||||||||||| | ||||| | |
|
|
| T |
31244876 |
tgtgatgatttggtatttctatcctctggtcttttaggccacaatatgcagagattggaaaaattattaaagaggtaacatgcttattgagtcacaaatc |
31244975 |
T |
 |
| Q |
283 |
ttcaactttacct |
295 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31244976 |
ttcaactttacct |
31244988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 181 - 297
Target Start/End: Complemental strand, 6472799 - 6472683
Alignment:
| Q |
181 |
catgtgatgatttggaatttctatcctctggtcttctaggccagaatatgcagagattggaaaaattattaaaaagttaacatgcttattgggaaacaaa |
280 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| || ||||||| ||||||| |||||||||||||||| ||| | ||||||||||||| || |
|
|
| T |
6472799 |
catgtgatgatttggaatttctattctctggtcttttaggtcacaatatgcggagattgaaaaaattattaaaaaggtaagaagcttattgggaaataag |
6472700 |
T |
 |
| Q |
281 |
acttcaactttacctgg |
297 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
6472699 |
actgaaactttaactgg |
6472683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University