View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_high_22 (Length: 315)

Name: NF10104A_high_22
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_high_22
NF10104A_high_22
[»] chr4 (1 HSPs)
chr4 (22-140)||(4824813-4824931)


Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 22 - 140
Target Start/End: Complemental strand, 4824931 - 4824813
Alignment:
22 atatttgacacattggttaggacacatgatgcctcgcattggtagaaacctttgccttccatattcgtcgccaaaaacccccggttgttcatgctggaat 121  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4824931 atatttgacacattgtttaggacacatgatgcctcgcattggtagaaacctttgccttccatattcgtcgccaaaaacccccggttgttcatgctggaat 4824832  T
122 tattaaatatgttacttgt 140  Q
    ||||||| |||||||||||    
4824831 tattaaagatgttacttgt 4824813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University