View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_high_34 (Length: 254)

Name: NF10104A_high_34
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_high_34
NF10104A_high_34
[»] chr8 (1 HSPs)
chr8 (35-254)||(40626100-40626319)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 35 - 254
Target Start/End: Original strand, 40626100 - 40626319
Alignment:
35 tgaacaatcaacctcttccagcttcatccatgagtcgcacctttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttc 134  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40626100 tgaacaatcaacctcttccagcttcatccatgagtcgcacgtttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttc 40626199  T
135 ttgtgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcgctcatcttttatgcaa 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40626200 ttgtgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcactcatcttttatgcaa 40626299  T
235 cccttaggcttgagtttgca 254  Q
    ||||||||||||||||||||    
40626300 cccttaggcttgagtttgca 40626319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University