View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_high_38 (Length: 250)

Name: NF10104A_high_38
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_high_38
NF10104A_high_38
[»] chr4 (1 HSPs)
chr4 (80-191)||(43921985-43922096)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 80 - 191
Target Start/End: Complemental strand, 43922096 - 43921985
Alignment:
80 gatgaaaatcaaggtttcaatttctatctccttttttattcatttcacctctcttattatcatcgatcgcactagaatccgtaattgcaccactagtatc 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43922096 gatgaaaatcaaggtttcaatttctatctccttttttattcatttcacctctcttattatcatcgatcgcactagaatccgtaattgcaccactagtatc 43921997  T
180 ttatcgattcta 191  Q
    ||||||||||||    
43921996 ttatcgattcta 43921985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University