View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_4 (Length: 523)
Name: NF10104A_high_4
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 6 - 417
Target Start/End: Original strand, 32927200 - 32927623
Alignment:
| Q |
6 |
aaacataacacatgaataataatagtatatatcaaaatgatgatgactacacattgacgcaacaccacatgataagaacaacaatgaaaccaacctttca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32927200 |
aaacataacacatgaataataatagtatatatcaaaatgatgatgactacacattgacgcaacaccacatgataagaacaacaatgtaaccaacctttca |
32927299 |
T |
 |
| Q |
106 |
caatta-------------ttaactcactcttcttctattacacagctcagcaacatcacgttccaaaaatcttctctgagacattttcacaaacacctt |
192 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927300 |
caattattttccattattattaactcactcttcttctattacacagctcagcaacatcacgttccaaaaatcttctctgagacattttcacaaacacctt |
32927399 |
T |
 |
| Q |
193 |
ttgggttaagaagatgagtttcagagaagagagtggtgatggaagggatcttcagaaaccgtttcttcatacgggtagttggtataaaatgggttcaaga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927400 |
ttgggttaagaagatgagtttcagagaagagagtggtgatggaagggatcttcagaaaccgtttcttcatacgggtagttggtataaaatgggttcaaga |
32927499 |
T |
 |
| Q |
293 |
caatctagtgttatgggttcaactacttcggttatgcgggattcagtttcggttctattttgtgttcttattgctgctttgggtccaattcaatttggct |
392 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927500 |
caatctagtgttatgggttcaactacttctgttatgcgggattcagtttcggttctattttgtgttcttattgctgctttgggtccaattcaatttggct |
32927599 |
T |
 |
| Q |
393 |
tcacggtctgctttagttcaattca |
417 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
32927600 |
tcacggtctg-tttagttcaattca |
32927623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University