View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_48 (Length: 222)
Name: NF10104A_high_48
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 33649868 - 33650050
Alignment:
Q |
18 |
aatatttggatatgagattgatagatccaaatttcaatacatgatttgattatttaaagnnnnnnnnnnctaaaataccgagtttaaaatcgttagcgtc |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
33649868 |
aatatttggatatgagattgatagatccaaatttcaatacatgatttgattatttaaagaaaaaaaaaactaaaataccgagtttaaaatcgttagcgtc |
33649967 |
T |
 |
Q |
118 |
cgattttgatccaacggttaaatttcatatcttggtgggtctaacaatgactacttcaattttaagctctaattgcatcttcc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33649968 |
cgattttgatccaacggttaaatttcatatcttggtgggtctaacaatgactacttcaattttaagctctaattgcatcttcc |
33650050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University