View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_high_5 (Length: 477)
Name: NF10104A_high_5
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_high_5 |
 |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 92 - 155
Target Start/End: Complemental strand, 10070362 - 10070299
Alignment:
| Q |
92 |
atcagttcttagcatccatttagatatcgatgaagaaacctccattctcatgataatatatttt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||| |||| |
|
|
| T |
10070362 |
atcagttcttagcatccatttagatatcgataaagaaacctctattttcatgataatatgtttt |
10070299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 376 - 432
Target Start/End: Complemental strand, 10069971 - 10069915
Alignment:
| Q |
376 |
ttgatccgttcgtgattgttgcactcactgtatatcgcattactgcattttaatggg |
432 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
10069971 |
ttgatccgttcgtgattgttgcactcgttgtatatagcattactgtattttaatggg |
10069915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 183
Target Start/End: Complemental strand, 5172162 - 5172125
Alignment:
| Q |
146 |
aatatattttatgcattgttcttaccaaccgagctaag |
183 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
5172162 |
aatatattttatgcattgtccataccaaccgagctaag |
5172125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 26320585 - 26320630
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||||| |||||||| |
|
|
| T |
26320585 |
atattttatgcattgtccataccaactgagctaagctcacgatgac |
26320630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 32149177 - 32149141
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
32149177 |
atatattatgcattgttcttaccaactgagctaagct |
32149141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 241406 - 241447
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
241406 |
atattttatgcattgttcataccaaccgagctaagcttacga |
241447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 37463561 - 37463516
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
37463561 |
atatattatgcattgttcataccaaccgagctaagctcacgatgac |
37463516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 54857637 - 54857684
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgaccg |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
54857637 |
atattttatgcattgtttataccaaccgagctaagctcacgaggaccg |
54857684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 9913939 - 9913897
Alignment:
| Q |
148 |
tatattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
9913939 |
tatattttatgcattgttcataccaactgagctaagctcacga |
9913897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 10303533 - 10303574
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
10303533 |
atattttatgcattgtccttaccaactgagctaagctcacga |
10303574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 185
Target Start/End: Original strand, 31604314 - 31604351
Alignment:
| Q |
148 |
tatattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
31604314 |
tatattttatgcattgttcttaccaactgagttaagct |
31604351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 35287529 - 35287570
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
35287529 |
atattttatgcattgttcataccaactgagctaagctcacga |
35287570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 31780784 - 31780748
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31780784 |
atattttatgcattgtccttaccaactgagctaagct |
31780748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000007; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 21497706 - 21497661
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
21497706 |
atatattatgcattgttcttaccaaccgagttaagctcacgatgac |
21497661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 148 - 190
Target Start/End: Original strand, 3752796 - 3752838
Alignment:
| Q |
148 |
tatattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
3752796 |
tatattttatgcattgttcataacaaccgagctaagctcacga |
3752838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 17736832 - 17736791
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
17736832 |
atattttatgcattgttcataccaactgagctaagctcacga |
17736791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 32957565 - 32957610
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| || |||||||| |
|
|
| T |
32957565 |
atatattatgcattgttcataccaaccgagctaaactcacgatgac |
32957610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 4056829 - 4056793
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
4056829 |
atatattatgcattgtccttaccaaccgagctaagct |
4056793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 27314906 - 27314870
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
27314906 |
atattttatgcattgttcttaccaactgagttaagct |
27314870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000007; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 29739376 - 29739335
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
29739376 |
atattttatgcattgtccttaccaactgagctaagctaacga |
29739335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 13673584 - 13673543
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13673584 |
atattttatgcattgttcaaaccaaccgagctaagctcacga |
13673543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 186
Target Start/End: Complemental strand, 21016001 - 21015964
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagcta |
186 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
21016001 |
atatattatgcattgttcttaccaactgagctaagcta |
21015964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 26498100 - 26498055
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||||| |||||||| |
|
|
| T |
26498100 |
atattttatgcattgtccgtaccaactgagctaagctcacgatgac |
26498055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 50595905 - 50595950
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
50595905 |
atattttatgcattgttcataccaattgagctaagctcacgatgac |
50595950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 46207799 - 46207752
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatgaccg |
196 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||| ||||| |
|
|
| T |
46207799 |
atattttatgcattgttcataccaactgagctaagctcacgaggaccg |
46207752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 13044164 - 13044206
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgat |
191 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
13044164 |
atattttatgcattgtccttaccaactgagctaagctcacgat |
13044206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 580948 - 580989
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
580948 |
atattttatgcattgtccataccaaccgagctaagctcacga |
580989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 47589575 - 47589616
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
47589575 |
atattttatgcattgttcataccaactgagctaagctcacga |
47589616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 13955519 - 13955483
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
13955519 |
atattttatgcattgttcataccaactgagctaagct |
13955483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 32862659 - 32862619
Alignment:
| Q |
148 |
tatattttatgcattgttcttaccaaccgagctaagctaac |
188 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||| |
|
|
| T |
32862659 |
tatattttatgcgttgttcttaccaactgagttaagctaac |
32862619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 193
Target Start/End: Complemental strand, 35666342 - 35666298
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacgatga |
193 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
35666342 |
atatattatgcattgtccttaccaaccgagttaagctcacgatga |
35666298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 53705650 - 53705685
Alignment:
| Q |
150 |
tattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53705650 |
tattttatgcattgttcttaccaactgagctaagct |
53705685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 7868761 - 7868720
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7868761 |
atatattatgcattgttcttaccaactgagctaagctcacga |
7868720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 52575986 - 52575945
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
52575986 |
atattttatgcattgttcataccaactgagctaagcttacga |
52575945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 13800706 - 13800670
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
13800706 |
atatattatgcattgttcttaccaactgagctaagct |
13800670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 41737835 - 41737799
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
41737835 |
atattttatgcattgtccttaccaactgagctaagct |
41737799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 22619914 - 22619872
Alignment:
| Q |
148 |
tatattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
22619914 |
tatattttatgcattgttcataccaactgagctaagctcacga |
22619872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 18391639 - 18391603
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
18391639 |
atattttatgcattgtccttaccaactgagctaagct |
18391603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 5464 - 5423
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5464 |
atatattatgcattgttcttaccaactgagctaagctcacga |
5423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 171198 - 171157
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagctaacga |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
171198 |
atattttatgcattgttcaaaccaaccgagctaagctcacga |
171157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 25734 - 25698
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
25734 |
atatattatgcattgttcttaccaactgagctaagct |
25698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000007; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Original strand, 9656019 - 9656055
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
9656019 |
atattttatgcattgtccttaccaactgagctaagct |
9656055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 32878700 - 32878664
Alignment:
| Q |
149 |
atattttatgcattgttcttaccaaccgagctaagct |
185 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
32878700 |
atatattatgcattgttcttaccaactgagctaagct |
32878664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 35103140 - 35103100
Alignment:
| Q |
154 |
ttatgcattgttcttaccaaccgagctaagctaacgatgac |
194 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
35103140 |
ttatgcattgttcataccaactgagctaagctcacgatgac |
35103100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University